Chinese (Simplified)
English
German
Korean
Spanish
Sign up for an account to enjoy easy online shopping and instant order tracking.
The antibody against ASCT2/SLC1A5 was raised in Rabbit using the recombinant fusion protein containing a sequence corresponding to amino acids 483-541 of human ASCT2/SLC1A5(NP_005619.1) as the immunogen. The monoclonal antibody exists as a isotype IgG, by affinity purification. This antibody has been validated on WB, IHC-P, ELISA.
The antibody against ASCT2/SLC1A5 was raised in Rabbit using the recombinant fusion protein containing a sequence corresponding to amino acids 483-541 of human ASCT2/SLC1A5(NP_005619.1) as the immunogen. The monoclonal antibody exists as a isotype IgG, by affinity purification. This antibody has been validated on WB, IHC-P, ELISA.
| Cat.No | ADA-15131A | Clonality | Monoclonal |
|---|---|---|---|
| Host Species | Rabbit | Target Name | ASCT2/SLC1A5 |
| Target Synonyms | R16; AAAT; ATBO; M7V1; RDRC; ASCT2; M7VS1; ASCT2/SLC1A5 | Form | Liquid |
| Species Reactivity | Human, Mouse | Isotype | IgG |
| Storage Buffer | 50% Glycerol, 0.05% BSA, PBS with 0.05% proclin300, pH7.3. | Purification Method | Affinity purification |
| Positive Samples | 293F, Jurkat | Application | ELISA, WB, IHC-P |
| Immunogen Description | Recombinant fusion protein containing a sequence corresponding to amino acids 483-541 of human ASCT2/SLC1A5(NP_005619.1). | Target Species | Human |
|---|---|---|---|
| Immunogen Sequence | CAAAATTACGTGGACCGTACGGAGTCGAGAAGCACAGAGCCTGAGTTGATACAAGTGAAGAGTGAGCTGCCCCTGGATCCGCTGCCAGTCCCCACTGAGGAAGGAAACCCCCTCCTCAAACACTATCGGGGGCCCGCAGGGGATGCCACGGTCGCCTCTGAGAAGGAATCAGTCATG | Uniprot ID | Q15758 |
Uniprot Id
Q15758
Target Species
Human
Target Name
SLC1A5
Target Full Name
Neutral amino acid transporter B(0)
Target Function
Sodium-dependent amino acids transporter that has a broad substrate specificity, with a preference for zwitterionic amino acids. It accepts as substrates all neutral amino acids, including glutamine, asparagine, and branched-chain and aromatic amino acids, and excludes methylated, anionic, and cationic amino acids. Through binding of the fusogenic protein syncytin-1/ERVW-1 may mediate trophoblasts syncytialization, the spontaneous fusion of their plasma membranes, an essential process in placental development.; (Microbial infection) Acts as a cell surface receptor for Feline endogenous virus RD114.; (Microbial infection) Acts as a cell surface receptor for Baboon M7 endogenous virus.; (Microbial infection) Acts as a cell surface receptor for type D simian retroviruses.
Target Subcellular Location
Cell membrane; Multi-pass membrane protein. Melanosome. Note=Identified by mass spectrometry in melanosome fractions from stage I to stage IV.
Target Protein Families
Dicarboxylate/amino acid:cation symporter (DAACS) (TC 2.A.23) family, SLC1A5 subfamily
Target Tissue Specificity
Placenta, lung, skeletal muscle, kidney, pancreas, and intestine.
Target Synonyms
ASCT2; AAAT; AAAT_HUMAN; ATB(0); ATBO; Baboon M7 virus receptor; FLJ31068; M7V1; M7VS1; Neutral amino acid transporter B(0); R16; RD114/simian type D retrovirus receptor; RDR; RDRC; SLC1A5; Sodium dependent neutral amino acid transporter type 2; Sodium-dependent neutral amino acid transporter type 2; Solute carrier family 1 (neutral amino acid transporter); member 5; Solute carrier family 1 member 5
Target Background
The SLC1A5 gene encodes a sodium-dependent neutral amino acid transporter that can act as a receptor for RD114/type D retrovirus (Larriba et al., 2001 [PubMed 11781704]).
Free shipping on orders $999+
Advenit post multos Scudilo Scutariorum tribunus velament
We accept credit cards, PayPal, and bank wires
Responsive and knowledgable customer service via email, text or phone
Notification
